Stem-loop sequence aca-mir-489

AccessionMI0018877 (change log)
DescriptionAnolis carolinensis miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
   -----   a    ---    ug             c      ua    uu 
5'      gug uggc   uugg  gucguauguauga gucauu  cuug  c
        ||| ||||   ||||  ||||||||||||| ||||||  ||||   
3'      uac accg   aauc  cggcauguauacu caguga  ggau  u
   caggg   -    uca    gu             a      --    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 21750899-21750989 [-]
sense
ENSACAT00000020756 ; aca-mir-489-201; exon 1
Database links

Mature sequence aca-miR-489-5p

Accession MIMAT0021974
Sequence

13 - 

uggucguauguaugacgucauu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-489-3p

Accession MIMAT0021975
Sequence

52 - 

gugacaucauauguacggcugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).