Stem-loop sequence aca-mir-460a

AccessionMI0018875 (change log)
DescriptionAnolis carolinensis miR-460a stem-loop
Gene family MIPF0000134; mir-460
Stem-loop
   u   -c      g c ug       ca a     ug augg 
5'  gac  uuauag a c  cauugua  c cugug  u    a
    |||  |||||| | |  |||||||  | |||||  |    c
3'  cug  gauauc u g  guaacau  g gacac  g    u
   a   aa      g a gu       ac c     gu gagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343687.1: 195334-195417 [-]
sense
ENSACAT00000020401 ; aca-mir-460a-201; exon 1
ENSACAT00000004814 ; PTH1R-201; intron 7
Database links

Mature sequence aca-miR-460a-5p

Accession MIMAT0021970
Sequence

14 - 

ccugcauuguacacacugugug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-460a-3p

Accession MIMAT0021971
Sequence

51 - 

cacagcgcauacaauguggau

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).