Stem-loop sequence aca-mir-458

AccessionMI0018874 (change log)
DescriptionAnolis carolinensis miR-458 stem-loop
Gene family MIPF0000179; mir-458
Stem-loop
        g       cg      uu        aa   cu 
5' gugca auggcag  ccauuu  ggagcuau  aca  c
   ||||| |||||||  ||||||  ||||||||  |||  u
3' caugu uaccguc  gguaag  ucucgaua  ugu  c
        a       au      uu        -c   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 121791160-121791237 [-]
sense
ENSACAT00000018331 ; aca-mir-458-201; exon 1
ENSACAT00000015838 ; HTR4-201; intron 7
Database links

Mature sequence aca-miR-458

Accession MIMAT0021969
Sequence

48 - 

auagcucuuugaaugguacugc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).