Stem-loop sequence aca-mir-457

AccessionMI0018873 (change log)
DescriptionAnolis carolinensis miR-457 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   g    -     g  cc        -uu          a u   cacc 
5'  gccg guccc cu  agcagcac   caauauuggc g guc    c
    |||| ||||| ||  ||||||||   |||||||||| | |||     
3'  cggc cgggg ga  ucgucgug   guuaugaccg c cgg    c
   a    u     g  cc        ucc          - -   ccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aca-miR-457-5p

Accession MIMAT0021967
Previous IDsaca-miR-457
Sequence

15 - 

cagcagcacuucaauauuggca

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-457-3p

Accession MIMAT0021968
Previous IDsaca-miR-457*
Sequence

57 - 

ccaguauugccugugcugcucca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).