Stem-loop sequence aca-mir-456

AccessionMI0018872 (change log)
DescriptionAnolis carolinensis miR-456 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
   --u    u   u        g   g     uc       acau ug    c 
5'    guua gug auguguga cag caucu  ucagccu    g  gauu c
      |||| ||| |||||||| ||| |||||  |||||||    |  ||||  
3'    uaau uac uacauacu guu guaga  ggucgga    c  cuaa u
   cug    c   u        -   g     uu       ---- gu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 231781979-231782075 [-]
sense
ENSACAT00000020288 ; aca-mir-456-201; exon 1
ENSACAT00000008982 ; TTC27-201; intron 9
Database links

Mature sequence aca-miR-456

Accession MIMAT0021966
Sequence

59 - 

caggcugguuagaugguuguc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).