Stem-loop sequence aca-mir-455

AccessionMI0018871 (change log)
DescriptionAnolis carolinensis miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   ------u  c   c ug  g          u      a   c   gga 
5'        cc ugg g  gg guaugugccc uggacu cau gug   g
          || ||| |  || |||||||||| |||||| ||| |||    
3'        gg acu c  uc cauauacggg accuga gua cac   c
   uuuauuu  a   c gu  a          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343398.1: 893149-893240 [-]
sense
ENSACAT00000020537 ; aca-mir-455-201; exon 1
ENSACAT00000014273 ; COL27A1-201; intron 14
Database links

Mature sequence aca-miR-455-5p

Accession MIMAT0021964
Sequence

16 - 

uaugugcccuuggacuacaucg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-455-3p

Accession MIMAT0021965
Sequence

54 - 

gcaguccaugggcauauacac

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).