Stem-loop sequence aca-mir-454

AccessionMI0018870 (change log)
DescriptionAnolis carolinensis miR-454 stem-loop
Gene family MIPF0000174; mir-454
Stem-loop
   cccugugagaa   ug    u          ---         cu      cu  g 
5'            cuc  agga aagacccuau   caauauugc  cugcuu  gu c
              |||  |||| ||||||||||   |||||||||  ||||||  || u
3'            ggg  uucu uucugggaua   guuauaacg  gaugaa  ua g
   -------cgga   gu    u          uuc         -u      cu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343282.1: 1189889-1189992 [-]
sense
ENSACAT00000020480 ; aca-mir-454-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-454
aca-mir-454GL343282.1: 1189889-1189992 [-]
aca-mir-130bGL343282.1: 1188352-1188439 [-]
Database links

Mature sequence aca-miR-454-5p

Accession MIMAT0021962
Previous IDsaca-miR-454*
Sequence

5 - 

gugagaacucugaggauaag

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-454-3p

Accession MIMAT0021963
Previous IDsaca-miR-454
Sequence

65 - 

uagugcaauauugcuuauagggu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).