Stem-loop sequence aca-mir-449b

AccessionMI0018868 (change log)
DescriptionAnolis carolinensis miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
             c u   c      cu        g    u     au 
5' gacugugucg u ugg agugca  acuagcug cugu gagau  a
   |||||||||| | ||| ||||||  |||||||| |||| |||||   
3' cugacguagu a acc ucacgu  ugauuggu gaca uuuua  u
             c c   -      --        -    u     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 2663679-2663768 [+]
sense
ENSACAT00000015475 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from aca-mir-449b
aca-mir-449bchr2: 2663679-2663768 [+]
aca-mir-449achr2: 2665566-2665652 [+]
aca-mir-449cchr2: 2666231-2666305 [+]
Database links

Mature sequence aca-miR-449b

Accession MIMAT0021959
Sequence

14 - 

uggcagugcacuacuagcuggc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).