Stem-loop sequence aca-mir-449a

AccessionMI0018867 (change log)
DescriptionAnolis carolinensis miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ---     g     a       guau          au a    c 
5'    ugugu gugga uggcagu    uguuagcugg  g guau u
      ||||| ||||| |||||||    ||||||||||  | ||||  
3'    acacg caucu accgucg    acagucgacc  c cgua c
   uau     g     a       acuu          -c -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 2665566-2665652 [+]
sense
ENSACAT00000018936 ; aca-mir-449a-201; exon 1
ENSACAT00000015475 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from aca-mir-449a
aca-mir-449bchr2: 2663679-2663768 [+]
aca-mir-449achr2: 2665566-2665652 [+]
aca-mir-449cchr2: 2666231-2666305 [+]
Database links

Mature sequence aca-miR-449a

Accession MIMAT0021958
Sequence

13 - 

uggcaguguauuguuagcugga

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).