Stem-loop sequence aca-mir-425

AccessionMI0018865 (change log)
DescriptionAnolis carolinensis miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
   gca              au       u  cu   ---    -a  ga 
5'    ggaaugguuuugga  gacacga ca  ccc   gcug  gc  g
      ||||||||||||||  ||||||| ||  |||   ||||  ||  c
3'    cuuuaucaaaaccu  cugugcu gu  ggg   cggc  cg  a
   aaa              gu       -  ag   cac    ac  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 187863021-187863112 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-425
aca-mir-191chr2: 187865095-187865184 [-]
aca-mir-425chr2: 187863021-187863112 [-]
aca-mir-2970chr2: 187861413-187861498 [-]
Database links

Mature sequence aca-miR-425-5p

Accession MIMAT0021954
Previous IDsaca-miR-425
Sequence

17 - 

aaugacacgaucacucccgcu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-425-3p

Accession MIMAT0021955
Previous IDsaca-miR-425*
Sequence

56 - 

ccacggggaugucgugucuguc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).