Stem-loop sequence aca-mir-383

AccessionMI0018864 (change log)
DescriptionAnolis carolinensis miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
      -c  a      aa    a        -uug uuu 
5' cuc  uc gaucag  ggug uuguggcu    c   u
   |||  || ||||||  |||| ||||||||    |    
3' gag  ag cugguc  ucac gacaccga    g   a
      aa  a      cg    -        caaa uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 106709391-106709463 [-]
sense
ENSACAT00000020410 ; aca-mir-383-201; exon 1
Database links

Mature sequence aca-miR-383-5p

Accession MIMAT0021952
Previous IDsaca-miR-383
Sequence

7 - 

agaucagaaggugauuguggc

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-383-3p

Accession MIMAT0021953
Previous IDsaca-miR-383*
Sequence

49 - 

cacagcacugccuggucagaa

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).