Stem-loop sequence aca-mir-375

AccessionMI0018863 (change log)
DescriptionAnolis carolinensis miR-375 stem-loop
Gene family MIPF0000114; mir-375
Stem-loop
   cugggcuacu    ug       c   u      cc   c       c ga 
5'           gcug  cuugccu gcg cgagcc  acg acaagac u  c
             ||||  ||||||| ||| ||||||  ||| ||||||| |  g
3'           cgac  ggacgga ugc gcucgg  ugc uguuuug a  u
   ----ucuauc    cu       u   -      cu   u       u ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 87863736-87863835 [-]
intergenic
Database links

Mature sequence aca-miR-375-5p

Accession MIMAT0021950
Previous IDsaca-miR-375*
Sequence

25 - 

gcgucgagccccacgcacaaga

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-375-3p

Accession MIMAT0021951
Previous IDsaca-miR-375
Sequence

61 - 

uuuguucguucggcucgcguua

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).