Stem-loop sequence aca-mir-367

AccessionMI0018862 (change log)
DescriptionAnolis carolinensis miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
     u             u      c   --    u 
5' cc uuacuguugcuaa gugcaa ucu  guua g
   || ||||||||||||| |||||| |||  ||||  
3' gg agugguaacgauu cacguu agg  uaau u
     u             u      a   uc    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 142964147-142964214 [+]
antisense
ENSACAT00000010712 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from aca-mir-367
aca-mir-302bchr5: 142962973-142963049 [+]
aca-mir-302achr5: 142963789-142963856 [+]
aca-mir-367chr5: 142964147-142964214 [+]
Database links

Mature sequence aca-miR-367

Accession MIMAT0021949
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).