Stem-loop sequence aca-mir-363

AccessionMI0018860 (change log)
DescriptionAnolis carolinensis miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   cuugu       u   gu         ca  a         gauuagau 
5'      guuuugc guu  cggguggau  cg ugcaauuuu        u
        ||||||| |||  |||||||||  || |||||||||         
3'      caggacg caa  gucuaccua  gc acguuaaaa        a
   gcuuc       c   au         ug  -         gcaggacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL344214.1: 24588-24686 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-363
aca-mir-106GL344214.1: 22319-22394 [+]
aca-mir-18bGL344214.1: 22462-22553 [+]
aca-mir-20bGL344214.1: 24032-24114 [+]
aca-mir-19cGL344214.1: 24230-24313 [-]
aca-mir-92a-2GL344214.1: 24426-24524 [+]
aca-mir-363GL344214.1: 24588-24686 [+]
Database links

Mature sequence aca-miR-363-5p

Accession MIMAT0021945
Previous IDsaca-miR-363*
Sequence

22 - 

guggaucacgaugcaauuuuga

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-363-3p

Accession MIMAT0021946
Previous IDsaca-miR-363
Sequence

62 - 

aauugcacgguauccaucugu

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).