Stem-loop sequence aca-mir-34c

AccessionMI0018859 (change log)
DescriptionAnolis carolinensis miR-34c stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   ug    -gua       u      c       g   u 
5'   guuu    ggcagug aguuag ugauugu agg u
     ||||    ||||||| |||||| ||||||| |||  
3'   caaa    cugucau ucgauc acuaacg uuc u
   -a    acua       u      -       g   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343521.1: 197479-197551 [-]
sense
ENSACAT00000020359 ; aca-mir-34c-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-34c
aca-mir-34cGL343521.1: 197479-197551 [-]
aca-mir-34aGL343521.1: 196050-196111 [-]
Database links

Mature sequence aca-miR-34c-5p

Accession MIMAT0021943
Previous IDsaca-miR-34c
Sequence

9 - 

aggcaguguaguuagcugauug

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-34c-3p

Accession MIMAT0021944
Previous IDsaca-miR-34c*
Sequence

46 - 

aaucacuagcuuuacugucau

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).