Stem-loop sequence aca-mir-34a

AccessionMI0018857 (change log)
DescriptionAnolis carolinensis miR-34a stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
    ug  a   a    a     c      acg 
5' u  cc ggc gugu guuag ugauug   a
   |  || ||| |||| ||||| ||||||   g
3' a  gg ccg caca caauc acugac   g
    gu  a   g    a     -      aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343521.1: 196050-196111 [-]
intergenic
Clustered miRNAs
< 10kb from aca-mir-34a
aca-mir-34cGL343521.1: 197479-197551 [-]
aca-mir-34aGL343521.1: 196050-196111 [-]
Database links

Mature sequence aca-miR-34a-5p

Accession MIMAT0021939
Previous IDsaca-miR-34a
Sequence

6 - 

aggcaguguaguuagcugauug

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-34a-3p

Accession MIMAT0021940
Previous IDsaca-miR-34a*
Sequence

39 - 

gucacuaacaacacggccaggu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).