Stem-loop sequence aca-mir-31

AccessionMI0018852 (change log)
DescriptionAnolis carolinensis miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   auucagagcu    c ga     g             ugaugag 
5'           ggag g  ggcaa auguuggcauagc       u
             |||| |  ||||| |||||||||||||       u
3'           ccuu c  ccguu uacaaccguaucg       a
   --------gu    u uc     a             uccaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 61607424-61607506 [+]
sense
ENSACAT00000020850 ; aca-mir-31-201; exon 1
Database links

Mature sequence aca-miR-31-5p

Accession MIMAT0021930
Previous IDsaca-miR-31
Sequence

18 - 

aggcaagauguuggcauagcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-31-3p

Accession MIMAT0021931
Previous IDsaca-miR-31*
Sequence

57 - 

uaugccaacauauugcccuc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).