Stem-loop sequence aca-mir-30d

AccessionMI0018850 (change log)
DescriptionAnolis carolinensis miR-30d stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   ac       u  u  u         ccc            ua 
5'   aguaguc gu gu guaaacauc   gacuggaagcug  a
     ||||||| || || |||||||||   ||||||||||||  a
3'   uuaucgg ca cg cguuuguag   cugacuuucgac  u
   ac       c  c  u         --a            uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 1751109-1751193 [-]
sense
ENSACAT00000019596 ; aca-mir-30d-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-30d
aca-mir-30dchr4: 1751109-1751193 [-]
aca-mir-30bchr4: 1747976-1748063 [-]
Database links

Mature sequence aca-miR-30d-5p

Accession MIMAT0021926
Previous IDsaca-miR-30d
Sequence

16 - 

uguaaacauccccgacuggaag

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-30d-3p

Accession MIMAT0021927
Previous IDsaca-miR-30d*
Sequence

52 - 

uuucagucagauguuugcugc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).