Stem-loop sequence aca-mir-30c-1

AccessionMI0018849 (change log)
DescriptionAnolis carolinensis miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   ---     u a    uaau       u   aca         guguaga 
5'    ccaag g cagg    guaaaca ccu   cucucagcu       u
      ||||| | ||||    ||||||| |||   |||||||||        
3'    gguuc c gucu    cauuugu gga   gagggucga       a
   aaa     - -    cucu       c   --a         aagaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 168132504-168132596 [-]
sense
ENSACAT00000020475 ; aca-mir-30c-201; exon 1
Database links

Mature sequence aca-miR-30c-5p

Accession MIMAT0021924
Previous IDsaca-miR-30c
Sequence

16 - 

uguaaacauccuacacucucagc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-30c-3p

Accession MIMAT0021925
Previous IDsaca-miR-30c*
Sequence

58 - 

cugggagaaggcuguuuacucu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).