Stem-loop sequence aca-mir-30b

AccessionMI0018848 (change log)
DescriptionAnolis carolinensis miR-30b stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   ua ug uuu      cau        c uaca         a  a 
5'   c  a   uuaguu   guaaacau c    cucagcugu uc c
     |  |   ||||||   |||||||| |    ||||||||| ||  
3'   g  u   agucaa   cauuugua g    gggucggua ag a
   -- gu --u      cuu        a uaga         a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 1747976-1748063 [-]
sense
ENSACAT00000020667 ; aca-mir-30b-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-30b
aca-mir-30dchr4: 1751109-1751193 [-]
aca-mir-30bchr4: 1747976-1748063 [-]
Database links

Mature sequence aca-miR-30b-5p

Accession MIMAT0021922
Previous IDsaca-miR-30b
Sequence

18 - 

uguaaacauccuacacucagcu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-30b-3p

Accession MIMAT0021923
Previous IDsaca-miR-30b*
Sequence

56 - 

cugggagaugaauguuuacuuc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).