Stem-loop sequence aca-mir-302b

AccessionMI0018846 (change log)
Previous IDsaca-mir-302
DescriptionAnolis carolinensis miR-302b stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
   gacu         uu          ug   u  gugca 
5'     gcuucuacu  aacauggagg  cuu cu     u
       |||||||||  ||||||||||  ||| ||      
3'     uggagauga  uuguaccuuc  gaa ga     a
   -aag         uu          gu   u  aaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 142962973-142963049 [+]
antisense
ENSACAT00000010712 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from aca-mir-302b
aca-mir-302bchr5: 142962973-142963049 [+]
aca-mir-302achr5: 142963789-142963856 [+]
aca-mir-367chr5: 142964147-142964214 [+]
Database links

Mature sequence aca-miR-302b

Accession MIMAT0021919
Previous IDsaca-miR-302
Sequence

48 - 

uaagugcuuccauguuuuaguag

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).