Stem-loop sequence aca-mir-29b-2

AccessionMI0018843 (change log)
DescriptionAnolis carolinensis miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --cuggagc   cu     -a          u      gu      uuaag 
5'          ucc  cagga  gcugguuuca auggug  uuagau     u
            |||  |||||  |||||||||| ||||||  ||||||     a
3'          agg  guucu  ugacuaaagu uaccac  gaucug     c
   acgguaaga   ag     cg          u      --      uaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 1037450-1037549 [-]
sense
ENSACAT00000020600 ; aca-mir-29b-2-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-29b-2
aca-mir-29b-2chr5: 1037450-1037549 [-]
aca-mir-29a-1chr5: 1036133-1036229 [-]
Database links

Mature sequence aca-miR-29b

Accession MIMAT0021914
Sequence

60 - 

uagcaccauuugaaaucagug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).