Stem-loop sequence aca-mir-29b-1

AccessionMI0018842 (change log)
DescriptionAnolis carolinensis miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   -   ug    - cu      -          c      g  u    uuuucc 
5'  gug  ucuu c  cuggaa gcugguuuca auggug cu agau      a
    |||  |||| |  |||||| |||||||||| |||||| || ||||       
3'  cau  agaa g  gaucuu ugacuaaagu uaccac ga ucua      u
   a   ua    c ag      g          u      -  -    uguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343255.1: 1940177-1940277 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-29b-1
aca-mir-29b-1GL343255.1: 1940177-1940277 [+]
aca-mir-29a-2GL343255.1: 1943470-1943565 [+]
Database links

Mature sequence aca-miR-29b

Accession MIMAT0021914
Sequence

61 - 

uagcaccauuugaaaucagug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).