Stem-loop sequence aca-mir-29a-2

AccessionMI0018841 (change log)
DescriptionAnolis carolinensis miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   ----cg         -  ggc           ucu       ---     uc 
5'       ucucuuaca ca   ugaccgauuuc   ugguguu   cagag  u
         ||||||||| ||   |||||||||||   |||||||   |||||  u
3'       gggggaugu gu   auuggcuaaag   accacga   guuuu  a
   cgaaaa         a  ---           uuu       ucu     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343255.1: 1943470-1943565 [+]
sense
ENSACAT00000018526 ; aca-mir-29a-2-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-29a-2
aca-mir-29b-1GL343255.1: 1940177-1940277 [+]
aca-mir-29a-2GL343255.1: 1943470-1943565 [+]
Database links

Mature sequence aca-miR-29a-2-5p

Accession MIMAT0021913
Previous IDsaca-miR-29a-2*
Sequence

17 - 

ugaccgauuucucuugguguuc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-29a-3p

Accession MIMAT0021912
Previous IDsaca-miR-29a
Sequence

57 - 

uagcaccauuugaaaucgguu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).