Stem-loop sequence aca-mir-2970

AccessionMI0018839 (change log)
DescriptionAnolis carolinensis miR-2970 stem-loop
Gene family MIPF0001328; mir-2970
Stem-loop
   aga    u      ag        u  u        caua   a 
5'    ucug cacugc  acagucag ag uggucugg    agc g
      |||| ||||||  |||||||| || ||||||||    ||| a
3'    aggu gugaug  ugucgguu uc acuagacu    uug a
   ccg    -      ag        c  c        ----   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 187861413-187861498 [-]
sense
ENSACAT00000023401 ; aca-mir-2970-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-2970
aca-mir-191chr2: 187865095-187865184 [-]
aca-mir-425chr2: 187863021-187863112 [-]
aca-mir-2970chr2: 187861413-187861498 [-]
Database links

Mature sequence aca-miR-2970-5p

Accession MIMAT0021909
Previous IDsaca-miR-2970
Sequence

16 - 

gacagucaguaguuggucugg

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-2970-3p

Accession MIMAT0021910
Previous IDsaca-miR-2970*
Sequence

52 - 

ucagaucaccucuuggcuguga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).