Stem-loop sequence aca-mir-27b

AccessionMI0018838 (change log)
DescriptionAnolis carolinensis miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

1 open access papers mention aca-mir-27b
(1 sentences)

Stem-loop
   ug                  auug        u  uug 
5'   aggugcagagcuuagcug    gugaacag ga   a
     ||||||||||||||||||    |||||||| ||   u
3'   uccacgucuugaaucggu    cacuuguu cu   u
   -a                  --ga        u  ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 40591774-40591849 [-]
sense
ENSACAT00000020516 ; aca-mir-27b-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-27b
aca-mir-23bchr2: 40591992-40592077 [-]
aca-mir-27bchr2: 40591774-40591849 [-]
aca-mir-24-2chr2: 40591310-40591402 [-]
Database links

Mature sequence aca-miR-27b-5p

Accession MIMAT0021907
Previous IDsaca-miR-27b*
Sequence

9 - 

agagcuuagcugauuggugaac

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-27b-3p

Accession MIMAT0021908
Previous IDsaca-miR-27b
Sequence

51 - 

uucacaguggcuaaguucugca

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).