Stem-loop sequence aca-mir-27a

AccessionMI0018837 (change log)
DescriptionAnolis carolinensis miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

1 open access papers mention aca-mir-27a
(1 sentences)

Stem-loop
   -   c ua          cac         gcau   au 
5'  agc g  gggcuuagcc   cugugaaca    ugg  u
    ||| |  ||||||||||   |||||||||    |||   
3'  ucg c  cuugaaucgg   gacacuugu    acc  c
   u   u gc          --u         ----   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 29157932-29158004 [-]
sense
ENSACAT00000020058 ; aca-mir-27a-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-27a
aca-mir-23achr2: 29158329-29158420 [-]
aca-mir-27achr2: 29157932-29158004 [-]
aca-mir-24-1chr2: 29157637-29157729 [-]
Database links

Mature sequence aca-miR-27a-5p

Accession MIMAT0021905
Previous IDsaca-miR-27a*
Sequence

7 - 

agggcuuagcccaccugugaac

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-27a-3p

Accession MIMAT0021906
Previous IDsaca-miR-27a
Sequence

48 - 

uucacaguggcuaaguuccgc

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).