Stem-loop sequence aca-mir-26-2

AccessionMI0018836 (change log)
DescriptionAnolis carolinensis miR-26-2 stem-loop
Gene family MIPF0000043; mir-26
Literature search

1 open access papers mention aca-mir-26-2
(2 sentences)

Stem-loop
   ---aga      ga    cuu         c            gugc 
5'       ggcugu  ccug   caaguaauc aggauaggcugu    a
         ||||||  ||||   ||||||||| ||||||||||||    u
3'       ccgaua  gggu   guucauuag uccuauccggua    u
   gcgaca      aa    cac         u            auuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr6: 1202352-1202445 [-]
sense
ENSACAT00000018922 ; aca-mir-26-2-201; exon 1
ENSACAT00000005564 ; CTDSPL-201; intron 5
Database links

Mature sequence aca-miR-26-5p

Accession MIMAT0021902
Previous IDsaca-miR-26
Sequence

17 - 

uucaaguaauccaggauagg

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-26-2-3p

Accession MIMAT0021904
Previous IDsaca-miR-26-2*
Sequence

56 - 

ccuauccuugauuacuugcacu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).