Stem-loop sequence aca-mir-26-1

AccessionMI0018835 (change log)
DescriptionAnolis carolinensis miR-26-1 stem-loop
Gene family MIPF0000043; mir-26
Literature search

1 open access papers mention aca-mir-26-1
(2 sentences)

Stem-loop
   gua  a  a    gg    uu          c           ugggu 
5'    ac gg cugu  ccag  ucaaguaauc aggauaggcug     a
      || || ||||  ||||  |||||||||| |||||||||||     c
3'    ug cc gacg  gguu  gguucauuag ucuuguccgac     u
   --g  g  -    ga    cc          u           uguag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 88581308-88581403 [-]
sense
ENSACAT00000002018 ; CTDSP1-201; intron 4
Database links

Mature sequence aca-miR-26-5p

Accession MIMAT0021902
Previous IDsaca-miR-26
Sequence

21 - 

uucaaguaauccaggauagg

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-26-1-3p

Accession MIMAT0021903
Previous IDsaca-miR-26-1*
Sequence

60 - 

ccuguucuugauuacuuggccu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).