Stem-loop sequence aca-mir-23a

AccessionMI0018831 (change log)
DescriptionAnolis carolinensis miR-23a stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   ---------c     cca c     -       ug          auuuu 
5'           cgcug   g ugggg uuccugg  augugauuuu     g
             |||||   | ||||| |||||||  ||||||||||      
3'           gugac   c accuu agggacc  uacacuaaga     g
   acgccaucga     uac a     u       gu          cuugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr2: 29158329-29158420 [-]
sense
ENSACAT00000019364 ; aca-mir-23a-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-23a
aca-mir-23achr2: 29158329-29158420 [-]
aca-mir-27achr2: 29157932-29158004 [-]
aca-mir-24-1chr2: 29157637-29157729 [-]
Database links

Mature sequence aca-miR-23a-5p

Accession MIMAT0021895
Previous IDsaca-miR-23a*
Sequence

13 - 

gggguuccuggugaugugauuu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-23a-3p

Accession MIMAT0021896
Previous IDsaca-miR-23a
Sequence

51 - 

aucacauugccagggauuucc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).