Stem-loop sequence aca-mir-223

AccessionMI0018830 (change log)
DescriptionAnolis carolinensis miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
   acgca     u    cc             u    ucgca     c uc 
5'      gggcu cccu  guguauuugacga cuga     cacuc g  u
        ||||| ||||  ||||||||||||| ||||     ||||| |  g
3'      uccgg ggga  cauauaaacuguu gacu     gugag c  c
   ---uc     c    aa             u    -----     a ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343465.1: 618358-618450 [+]
intergenic
Database links

Mature sequence aca-miR-223-5p

Accession MIMAT0021893
Previous IDsaca-miR-223*
Sequence

17 - 

cguguauuugacgaucugaucgc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-223-3p

Accession MIMAT0021894
Previous IDsaca-miR-223
Sequence

60 - 

ugucaguuugucaaauauacaa

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).