Stem-loop sequence aca-mir-222a

AccessionMI0018829 (change log)
Previous IDsaca-mir-222
DescriptionAnolis carolinensis miR-222 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   ugu  c   u      uc             -     auu   ucuu 
5'    ag ugu ccucag  gcucaguagucag uguag   cug    c
      || ||| ||||||  ||||||||||||| |||||   |||     
3'    uc aca ggaguc  ugggucaucgguc acauc   gac    u
   ugu  u   -      uc             u     gac   uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 135997318-135997411 [-]
sense
ENSACAT00000019491 ; aca-mir-222-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-222a
aca-mir-222achr3: 135997318-135997411 [-]
aca-mir-221chr3: 135996379-135996459 [-]
Database links

Mature sequence aca-miR-222a-5p

Accession MIMAT0021891
Previous IDsaca-miR-222-5p
Sequence

19 - 

gcucaguagucaguguagauuc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-222a-3p

Accession MIMAT0021892
Previous IDsaca-miR-222-3p
Sequence

57 - 

agcuacaucuggcuacuggguc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).