Stem-loop sequence aca-mir-221

AccessionMI0018828 (change log)
DescriptionAnolis carolinensis miR-221 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   uugg        -  ug   u         aauu     u u 
5'     ggccugaa cc  gca acaauguag    cuguu g u
       |||||||| ||  ||| |||||||||    ||||| | a
3'     ucggacuu gg  cgu uguuacauc    gacaa c a
   ucug        u  gu   c         ----     - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr3: 135996379-135996459 [-]
sense
ENSACAT00000018379 ; aca-mir-221-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-221
aca-mir-222achr3: 135997318-135997411 [-]
aca-mir-221chr3: 135996379-135996459 [-]
Database links

Mature sequence aca-miR-221-5p

Accession MIMAT0021889
Previous IDsaca-miR-221*
Sequence

11 - 

aaccuggcauacaauguagaauu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-221-3p

Accession MIMAT0021890
Previous IDsaca-miR-221
Sequence

50 - 

agcuacauugucugcuggguuu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).