Stem-loop sequence aca-mir-219-1

AccessionMI0018825 (change log)
DescriptionAnolis carolinensis miR-219-1 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   uccagaaggaac   u  uc u   u     a            uccagaaa 
5'             cuu gc  c gau gucca acgcaauucuug        a
               ||| ||  | ||| ||||| ||||||||||||         
3'             gaa cg  g cua caggu uguguuaagaac        c
   ---------ucu   c  gu u   -     c            caaacgua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL344072.1: 36976-37071 [+]
intergenic
Database links

Mature sequence aca-miR-219-5p

Accession MIMAT0021884
Previous IDsaca-miR-219
Sequence

22 - 

ugauuguccaaacgcaauucuug

 - 44

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-219-1-3p

Accession MIMAT0021885
Previous IDsaca-miR-219-1*
Sequence

64 - 

aagaauugugucuggacaucug

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).