Stem-loop sequence aca-mir-2188

AccessionMI0018824 (change log)
DescriptionAnolis carolinensis miR-2188 stem-loop
Gene family MIPF0000812; mir-2188
Literature search

1 open access papers mention aca-mir-2188
(1 sentences)

Stem-loop
   ggacau   c   ---       u a     ca   u          gua gcg 
5'       cau aca   cuugugg c agguc  acc cacguguccu   u   a
         ||| |||   ||||||| | |||||  ||| ||||||||||   |    
3'       gua ugu   gaacacc g uccag  ugg gugcguaggg   a   u
   ------   -   ccc       c a     ac   u          -ag aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343545.1: 105058-105156 [-]
sense
ENSACAT00000021811 ; aca-mir-2188-201; exon 1
ENSACAT00000012378 ; ANK1-201; intron 2
Database links

Mature sequence aca-miR-2188-5p

Accession MIMAT0021882
Previous IDsaca-miR-2188
Sequence

23 - 

aagguccaaccucacguguc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-2188-3p

Accession MIMAT0021883
Previous IDsaca-miR-2188*
Sequence

62 - 

gaugcguguggucagaccuag

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).