Stem-loop sequence aca-mir-217

AccessionMI0018821 (change log)
DescriptionAnolis carolinensis miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   uuuu     c c  a  c     c          u  ggaaua 
5'     gaugu g ag ua ugcau aggaacugau gg      a
       ||||| | || || ||||| |||||||||| ||       
3'     cuacg c uc gu acgua uccuugacua cc      u
   aaau     a u  c  u     a          -  auguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 256233867-256233953 [-]
sense
ENSACAT00000018833 ; aca-mir-217-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-217
aca-mir-216achr1: 256236287-256236387 [-]
aca-mir-217chr1: 256233867-256233953 [-]
Database links

Mature sequence aca-miR-217-5p

Accession MIMAT0021878
Previous IDsaca-miR-217
Sequence

16 - 

uacugcaucaggaacugauugg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-217-3p

Accession MIMAT0021879
Previous IDsaca-miR-217*
Sequence

53 - 

caucaguuccuaaugcauugcc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).