Stem-loop sequence aca-mir-216b

AccessionMI0018820 (change log)
DescriptionAnolis carolinensis miR-216b stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   ucaa    a    c  -    a       a  c  a     ---   cuu 
5'     aguc caga ug agaa ucucugc gg aa uguga   ugu   g
       |||| |||| || |||| ||||||| || || |||||   |||    
3'     ucag gucu ac ucuu ggagacg cc uu acacu   acg   a
   -ucg    -    a  g    -       a  a  g     cua   acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 256248873-256248967 [-]
intergenic
Database links

Mature sequence aca-miR-216b-5p

Accession MIMAT0021876
Previous IDsaca-miR-216b
Sequence

19 - 

aaaucucugcaggcaaauguga

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-216b-3p

Accession MIMAT0021877
Previous IDsaca-miR-216b*
Sequence

60 - 

acaguuaccagcagagguucu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).