Stem-loop sequence aca-mir-216a

AccessionMI0018819 (change log)
DescriptionAnolis carolinensis miR-216a stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   aa   -ug      aa     u         cu   a        c  uu c 
5'   gga   gcugug  uuggu uaaucucag  ggc acugugag ag  u c
     |||   ||||||  ||||| |||||||||  ||| |||||||| ||  |  
3'   cuu   cgacac  aaucg auuaggguc  uug ugacacuc uc  a a
   -a   uaa      -a     u         -u   g        -  cu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 256236287-256236387 [-]
sense
ENSACAT00000019344 ; aca-mir-216a-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-216a
aca-mir-216achr1: 256236287-256236387 [-]
aca-mir-217chr1: 256233867-256233953 [-]
Database links

Mature sequence aca-miR-216a

Accession MIMAT0021875
Sequence

22 - 

uaaucucagcuggcaacuguga

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).