Stem-loop sequence aca-mir-210

AccessionMI0018815 (change log)
DescriptionAnolis carolinensis miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   ccaguuc   -        aug    a   acua       u  --u  uu 
5'        ucc aggagcag   agcc cug    acgcaca ug   gc  c
          ||| ||||||||   |||| |||    ||||||| ||   ||  u
3'        agg uuuucguc   ucgg gac    ugcgugu ac   ug  c
   ------c   c        caa    c   agug       c  ccc  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 74505514-74505609 [+]
intergenic
Database links

Mature sequence aca-miR-210-5p

Accession MIMAT0021867
Previous IDsaca-miR-210*
Sequence

22 - 

agccacugacuaacgcacauug

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-210-3p

Accession MIMAT0021868
Previous IDsaca-miR-210
Sequence

61 - 

cugugcgugugacagcggcua

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).