Stem-loop sequence aca-mir-20a

AccessionMI0018812 (change log)
DescriptionAnolis carolinensis miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -----ccu    c   -a       ua        g   ugau 
5'         guag acu  aagugcu  uagugcag uag    u
           |||| |||  |||||||  |||||||| |||    a
3'         cguc uga  uucacga  auuacguc auc    a
   augucgau    a   aa       gc        -   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343584.1: 108689-108770 [+]
sense
ENSACAT00000019592 ; aca-mir-20a-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-20a
aca-mir-17GL343584.1: 108264-108330 [+]
aca-mir-18aGL343584.1: 108387-108482 [+]
aca-mir-19aGL343584.1: 108526-108609 [+]
aca-mir-20aGL343584.1: 108689-108770 [+]
aca-mir-19bGL343584.1: 108832-108901 [+]
aca-mir-92a-1GL343584.1: 108945-109012 [+]
Database links

Mature sequence aca-miR-20a-5p

Accession MIMAT0021861
Previous IDsaca-miR-20a
Sequence

11 - 

uaaagugcuuauagugcaggua

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-20a-3p

Accession MIMAT0021862
Previous IDsaca-miR-20a*
Sequence

47 - 

acugcauuacgagcacuuaaagu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).