Stem-loop sequence aca-mir-206

AccessionMI0018810 (change log)
DescriptionAnolis carolinensis miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention aca-mir-206
(6 sentences)

Stem-loop
   -uuug                             c      -   au 
5'      ucuuuuugagauuacaugcuucuuuauau uccaua uga  u
        ||||||||||||||||||||||||||||| |||||| |||   
3'      agaggaacuuuggugugugaaggaaugua agguau guu  g
   caaga                             -      c   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 122853025-122853117 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-206
aca-mir-206chr1: 122853025-122853117 [+]
aca-mir-133bchr1: 122859594-122859686 [+]
Database links

Mature sequence aca-miR-206-5p

Accession MIMAT0021857
Previous IDsaca-miR-206*
Sequence

17 - 

uacaugcuucuuuauaucuccau

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-206-3p

Accession MIMAT0021858
Previous IDsaca-miR-206
Sequence

56 - 

uggaauguaaggaagugugug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).