Stem-loop sequence aca-mir-205b

AccessionMI0018809 (change log)
DescriptionAnolis carolinensis miR-205b stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   -cuug    cc       c   c        ucacc 
5'      ggug  cuucauu cac ggaaucug     g
        ||||  ||||||| ||| ||||||||     c
3'      ccac  gaaguaa gug cuuuaggc     a
   acgga    cc       a   u        caaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr5: 3605649-3605722 [+]
intergenic
Database links

Mature sequence aca-miR-205b

Accession MIMAT0021856
Sequence

9 - 

cccuucauuccaccggaaucugu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).