Stem-loop sequence aca-mir-205a

AccessionMI0018808 (change log)
DescriptionAnolis carolinensis miR-205a stem-loop
Gene family MIPF0000058; mir-205
Stem-loop
   gu   a    c           c        ucuca 
5'   ucu uugu cuucauuccac ggagucug     u
     ||| |||| ||||||||||| ||||||||     a
3'   aga aaca gaagugaggug cuuuagac     u
   ac   g    c           a        uaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 125660740-125660814 [+]
sense
ENSACAT00000018367 ; aca-mir-205a-201; exon 1
Database links

Mature sequence aca-miR-205a

Accession MIMAT0021855
Sequence

10 - 

uccuucauuccaccggagucug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).