Stem-loop sequence aca-mir-203

AccessionMI0018805 (change log)
DescriptionAnolis carolinensis miR-203 stem-loop
Gene family MIPF0000108; mir-203
Stem-loop
   caaau  -aa           gc         u    g    a     cuc 
5'      cc   gccugcugggu  agugguucu aaca uuca caguu   u
        ||   |||||||||||  ||||||||| |||| |||| |||||   a
3'      gg   cgggcggccua  ucaccagga uugu aagu guuaa   u
   -----  acc           gu         u    a    -     uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 5622429-5622526 [-]
sense
ENSACAT00000018880 ; aca-mir-203-201; exon 1
Database links

Mature sequence aca-miR-203-5p

Accession MIMAT0021851
Previous IDsaca-miR-203*
Sequence

23 - 

agugguucuuaacaguucaacag

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-203-3p

Accession MIMAT0021852
Previous IDsaca-miR-203
Sequence

61 - 

gugaaauguuuaggaccacuug

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).