Stem-loop sequence aca-mir-200a

Accession MI0018802
Description Anolis carolinensis miR-200a stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
acgaugaugg  -    g        -             c    uugu u 
          uc cucu uggacauc uuacuagacagug ugga    g g
          || |||| |||||||| ||||||||||||| ||||    |  
          ag ggga acuuguag aauggucugucac aucu    c c
---------g  u    a        c             a    uagu u 
Get sequence
Genome context
Coordinates (AnoCar2.0) Overlapping transcripts
GL343647.1: 276643-276735 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-200a
aca-mir-200b GL343647.1: 274634-274733 [+]
aca-mir-200a GL343647.1: 276643-276735 [+]
aca-mir-429 GL343647.1: 283324-283423 [+]

Mature sequence aca-miR-200a-5p

Accession MIMAT0021844
Previous IDs aca-miR-200a*
Sequence

22 - 

caucuuacuagacagugcug

 - 41

Get sequence
Evidence experimental; Solexa [1]

Mature sequence aca-miR-200a-3p

Accession MIMAT0021845
Previous IDs aca-miR-200a
Sequence

60 - 

uaacacugucugguaacgaugu

 - 81

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).