Stem-loop sequence aca-mir-200a

AccessionMI0018802 (change log)
DescriptionAnolis carolinensis miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   acgaugaugg  -    g        -             c    uugu u 
5'           uc cucu uggacauc uuacuagacagug ugga    g g
             || |||| |||||||| ||||||||||||| ||||    |  
3'           ag ggga acuuguag aauggucugucac aucu    c c
   ---------g  u    a        c             a    uagu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343647.1: 276643-276735 [+]
intergenic
Clustered miRNAs
< 10kb from aca-mir-200a
aca-mir-200bGL343647.1: 274634-274733 [+]
aca-mir-200aGL343647.1: 276643-276735 [+]
aca-mir-429GL343647.1: 283324-283423 [+]
Database links

Mature sequence aca-miR-200a-5p

Accession MIMAT0021844
Previous IDsaca-miR-200a*
Sequence

22 - 

caucuuacuagacagugcug

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-200a-3p

Accession MIMAT0021845
Previous IDsaca-miR-200a
Sequence

60 - 

uaacacugucugguaacgaugu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).