Stem-loop sequence aca-mir-1b

AccessionMI0018801 (change log)
DescriptionAnolis carolinensis miR-1b stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention aca-mir-1b
(6 sentences)

Stem-loop
   ug  --    -   ug gcc            c    gc     ugg    g 
5'   cc  uccc ucu  a   uacauacuucuu auau  ccaua   aguc g
     ||  |||| |||  |   |||||||||||| ||||  |||||   |||| c
3'   gg  aggg agg  u   auguaugaagaa ugua  gguau   uuag c
   -a  uu    u   gu gcu            u    -a     ---    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343308.1: 91113-91211 [+]
antisense
Clustered miRNAs
< 10kb from aca-mir-1b
aca-mir-1bGL343308.1: 91113-91211 [+]
aca-mir-133a-3GL343308.1: 91297-91373 [+]
Database links

Mature sequence aca-miR-1b-5p

Accession MIMAT0021842
Previous IDsaca-miR-1b*
Sequence

20 - 

cauacuucuucauaugcccau

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1b-3p

Accession MIMAT0021843
Previous IDsaca-miR-1b
Sequence

60 - 

uggaauguuaagaaguaugua

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).