Stem-loop sequence aca-mir-1a-2

AccessionMI0018800 (change log)
DescriptionAnolis carolinensis miR-1a-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention aca-mir-1a-2
(6 sentences)

Stem-loop
   uua  -        ug                gc     ugaacc 
5'    cc ugcuugag  acauacuucuuuauau  ccaua      u
      || ||||||||  ||||||||||||||||  |||||       
3'    gg auggacuu  uguaugaagaaaugua  gguau      g
   cca  u        ua                -a     caaacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 151823196-151823285 [+]
sense
ENSACAT00000019217 ; aca-mir-1a-2-201; exon 1
Database links

Mature sequence aca-miR-1a-2-5p

Accession MIMAT0021841
Previous IDsaca-miR-1a-2*
Sequence

16 - 

acauacuucuuuauaugccc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1a-3p

Accession MIMAT0021840
Previous IDsaca-miR-1a
Sequence

55 - 

uggaauguaaagaaguauguau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).