Stem-loop sequence aca-mir-1a-1

AccessionMI0018799 (change log)
DescriptionAnolis carolinensis miR-1a-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

1 open access papers mention aca-mir-1a-1
(6 sentences)

Stem-loop
   -auuaa      ug    c                ac     ugaaga 
5'       accugu  agag acauacuucuuuaugu  ccaua      u
         ||||||  |||| ||||||||||||||||  |||||       
3'       uggaua  uuuu uguaugaagaaaugua  gguau      a
   caaaca      gu    a                -a     uguaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr4: 38859440-38859535 [+]
antisense
ENSACAT00000007873 ; MIB1-201; intron 12
Clustered miRNAs
< 10kb from aca-mir-1a-1
aca-mir-1a-1chr4: 38859440-38859535 [+]
aca-mir-133a-2chr4: 38863208-38863304 [+]
Database links

Mature sequence aca-miR-1a-1-5p

Accession MIMAT0021839
Previous IDsaca-miR-1a-1*
Sequence

19 - 

acauacuucuuuauguacccau

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-1a-3p

Accession MIMAT0021840
Previous IDsaca-miR-1a
Sequence

58 - 

uggaauguaaagaaguauguau

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).