Stem-loop sequence aca-mir-19b

AccessionMI0018798 (change log)
DescriptionAnolis carolinensis miR-19b stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   -u             -  -      uc    ug     
5'   gguuaguuuugca gg uuugca  cagc  uaua 
     ||||||||||||| || ||||||  ||||  ||| a
3'   ucagucaaaacgu cc aaacgu  gucg  gugu 
   ug             a  u      --    uu     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343584.1: 108832-108901 [+]
sense
ENSACAT00000018123 ; aca-mir-19b-201; exon 1
Clustered miRNAs
< 10kb from aca-mir-19b
aca-mir-17GL343584.1: 108264-108330 [+]
aca-mir-18aGL343584.1: 108387-108482 [+]
aca-mir-19aGL343584.1: 108526-108609 [+]
aca-mir-20aGL343584.1: 108689-108770 [+]
aca-mir-19bGL343584.1: 108832-108901 [+]
aca-mir-92a-1GL343584.1: 108945-109012 [+]
Database links

Mature sequence aca-miR-19b

Accession MIMAT0021838
Sequence

44 - 

ugugcaaauccaugcaaaacu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).