Stem-loop sequence aca-mir-199b

AccessionMI0018796 (change log)
DescriptionAnolis carolinensis miR-199b stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   -----------  uc   ucc     c       u        c   u   gacu 
5'            cc  cac   gucug ccagugu cggacuac ugu cag    a
              ||  |||   ||||| ||||||| |||||||| ||| |||     
3'            gg  gug   cggau gguuaca gucugaug aca guu    c
   acgccauauag  uc   --u     u       c        -   u   agag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
GL343763.1: 95903-96000 [+]
antisense
Database links

Mature sequence aca-miR-199b-5p

Accession MIMAT0021835
Sequence

16 - 

cccaguguucggacuaccugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).