Stem-loop sequence aca-mir-199b

Accession MI0018796
Description Anolis carolinensis miR-199b stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-----------  uc   ucc     c       u        c   u   gacu 
           cc  cac   gucug ccagugu cggacuac ugu cag    a
           ||  |||   ||||| ||||||| |||||||| ||| |||     
           gg  gug   cggau gguuaca gucugaug aca guu    c
acgccauauag  uc   --u     u       c        -   u   agag 
Get sequence
Genome context
Coordinates (AnoCar2.0) Overlapping transcripts
GL343763.1: 95903-96000 [+]
antisense

Mature sequence aca-miR-199b-5p

Accession MIMAT0021835
Sequence

16 - 

cccaguguucggacuaccugu

 - 36

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).